Advanced search
Start date

Characterization of EIF4A3 expansions in Brazilian population

Grant number: 15/21781-6
Support type:Scholarships in Brazil - Scientific Initiation
Effective date (Start): February 01, 2016
Effective date (End): December 31, 2017
Field of knowledge:Biological Sciences - Genetics - Human and Medical Genetics
Principal researcher:Maria Rita dos Santos e Passos Bueno
Grantee:Gabriella Shih Ping Hsia
Home Institution: Instituto de Biociências (IB). Universidade de São Paulo (USP). São Paulo , SP, Brazil


Richieri Costa-Pereira Syndrome (RCPS) is an autossomal-recessive acrofacial dysostosis, characterized by several craniofacial anomalies, including midline cleft mandible, micrognathia among others, and limb defects. RCPS patients can also show intellectual disability and speech impairment. Our group has demonstrated that mutations in EIF4A3, mainly expansion at its promoter, cause RCPS. Sequencing analysis showed that these expansions present complex motifs, combined in different patterns and numbers per allele: CA-18nt (TCGGCAGCGGCAGCGAGG); CACA-20nt (TCGGCAGCGGCACAGCGAGG); and CGCA-20nt (TCGGCAGCGGCGCAGCGAGG). In a preliminary analysis, we observed that controls and patients have a different combination and numbers of these repeats: Controls have only the CA-18nt and CACA-20nt repeats in tandem and a total of 3 to 12 repeats, while RCPS patients have all 3 types of repeats (the CGCA-20nt motif is the most abundant) within the same allele and a total of 14 to 16 repeats. In a sample of 70 controls we did not find any allele pattern comparable to those found in affected individuals. In order to get insights in the arisen of this pathogenic expansion in our population, we are characterizing EIF4A3 allele variability in Brazilian population. This characterization will be done through Sanger Sequencing of approximately 400 samples, constituted of 190 individuals related to neuromuscular diseases (NMD) and 190 individuals related to orofacial clefts (OFC). For the analysis part, we will use two softwares, Sequencher 5.1 and Mixed Sequence Reader. With the characterization of controls' different motifs pattern we will have, as well, aids to test the relation between different motifs pattern and the EIF4A3' gene expression.

Scientific publications
(References retrieved automatically from Web of Science and SciELO through information on FAPESP grants and their corresponding numbers as mentioned in the publications by the authors)
HSIA, GABRIELLA S. P.; MUSSO, CAMILA M.; ALVIZI, LUCAS; BRITO, LUCIANO A.; KOBAYASHI, GERSON S.; PAVANELLO, RITA C. M.; ZATZ, MAYANA; GARDHAM, ALICE; WAKELING, EMMA; ZECHI-CEIDE, ROSELI M.; BERTOLA, DEBORA; PASSOS-BUENO, MARIA RITA. Complexity of the 5 ` Untranslated Region of EIF4A3, a Critical Factor for Craniofacial and Neural Development. FRONTIERS IN GENETICS, v. 9, APR 25 2018. Web of Science Citations: 0.

Please report errors in scientific publications list by writing to: