Busca avançada
Ano de início
Entree

Isolamento de sequencias de DNA repetitivas em escorpiões

Processo: 14/09414-5
Linha de fomento:Bolsas no Brasil - Programa Capacitação - Treinamento Técnico
Vigência (Início): 01 de julho de 2014
Vigência (Término): 30 de junho de 2015
Área do conhecimento:Ciências Biológicas - Zoologia - Morfologia dos Grupos Recentes
Pesquisador responsável:Marielle Cristina Schneider
Beneficiário:Renata Clicia dos Santos Costa Bueno
Instituição-sede: Instituto de Ciências Ambientais, Químicas e Farmacêuticas (ICAQF). Universidade Federal de São Paulo (UNIFESP). Campus Diadema. Diadema , SP, Brasil
Vinculado ao auxílio:11/21643-1 - Meiose em escorpiões (Arachnida): modelo para compreender a evolução em espécies com cromossomos aquiasmáticos, AP.JP
Assunto(s):Cromossomos   DNA ribossômico   Telômero   Hibridização in situ fluorescente

Resumo

Cerca de 80 espécies de escorpiões foram analisadas citogeneticamente; no entanto, menos de 20 foram caracterizadas quanto a distribuição das regiões heterocromáticas constitutivas ou organizadoras de nucléolo. Esse número é ainda menor (duas espécies) quando se considera a localização de regiões específicas, como os telomeros e os cístrons ribosomais, através da técnica de hibridização in situ com sonda fluorescente (FISH). O mapeamento físico utilizado para localizar segmentos específicos de DNA realizado através de métodos de citogenética molecular é bastante útil para compreender a organização e evolução do genoma dos organismos. Além disso, no caso dos escorpiões, a identificação de regiões cromossômicas adicionais pode auxiliar no entendimento dos rearranjos cromossômicos responsáveis pela variabilidade cariotípica presente no grupo. Com o objetivo de obter sondas de sequencias repetitivas do DNA, como os elementos de transposição e famílias multigênicas (histonas e rDNA), o bolsista de Treinamento Técnico 3 irá desenvolver as seguintes atividades: 1) manutenção da coleção de tecidos de escorpiões que foi iniciada neste Projeto; 2) extração de DNA de diferentes espécies e isolamento das sequencias repetitivas utilizando inicialmente primers do elemento transponível Mariner (Mar F - 5` GGAAGTCGTTTTTGCYTCNT e Mar R - 5´ATCGANCCATTCTTCCSCWC), gene ribosomal 5S (5S F - 5´ ACTTAGATGGGGGACCGCTT e 5S R - 5´ TTCAGCGTGGTATGGTCGTT) e histona H3 (H3 F - 5´ GGCNMGNACNAARCARAC e H3 R - 5´ TGDATRTCYTTNGGCATDAT); 3) Marcação das sondas para emprego da técnica de FISH. Outros primers poderão ser desenhados e testados, dependendo dos resultados obtidos.

Matéria(s) publicada(s) na Agência FAPESP sobre a bolsa:
Matéria(s) publicada(s) em Outras Mídias (0 total):
Mais itensMenos itens
VEICULO: TITULO (DATA)
VEICULO: TITULO (DATA)