Busca avançada
Ano de início
Entree

Caracterização das expansões do gene EIF4A3 na população brasileira

Processo: 15/21781-6
Linha de fomento:Bolsas no Brasil - Iniciação Científica
Vigência (Início): 01 de fevereiro de 2016
Vigência (Término): 31 de dezembro de 2017
Área do conhecimento:Ciências Biológicas - Genética - Genética Humana e Médica
Pesquisador responsável:Maria Rita dos Santos e Passos Bueno
Beneficiário:Gabriella Shih Ping Hsia
Instituição-sede: Instituto de Biociências (IB). Universidade de São Paulo (USP). São Paulo , SP, Brasil
Assunto(s):Anormalidades craniofaciais   Expressão gênica   Expansão das repetições de DNA

Resumo

A Síndrome de Richieri-Costa Pereira (RCPS) é uma doença autossômica recessiva relacionada à disostose acrofacial. O quadro clínico é caracterizado por anomalias craniofaciais severas que incluem fenda mandibular, micrognatia, entre outros. Além disso, pacientes com RCPS apresentam dificuldades na linguagem e no aprendizado. Nosso grupo demonstrou que mutações por expansão, na maioria dos casos, na região promotora (5'UTR) do gene EIF4A3 são as causas da síndrome. Através da análise do sequenciamento desta região, foi possível observar que essas expansões apresentam 3 motivos complexos que são diferentes em combinação de número e no padrão por alelo: CA-18nt (TCGGCAGCGGCAGCGAGG); CACA-20nt (TCGGCAGCGGCACAGCGAGG); e CGCA-20nt (TCGGCAGCGGCGCAGCGAGG). Ainda, nosso grupo observou que indivíduos controles e afetados possuem uma combinação diferente em número desses motivos: os indivíduos controles apresentam apenas os motivos CA-18nt e CACA-20nt em tandem e, no total, entre 3 e 12 repetições, enquanto os indivíduos afetados apresentam os 3 motivos em um mesmo alelo, sendo o motivo CGCA-20nt mais abundante e, no total, entre 14 a 16 repetições. No estudo inicial realizado pelo nosso grupo não foi encontrado nenhum alelo com padrão semelhante ao dos afetados dentro de uma amostra de 70 controles. Pretende-se, portanto, com essa proposta, esclarecer a origem do alelo associado à síndrome de RCPS, por meio da caracterização das expansões na população brasileira. Para isso, serão sequenciadas (por meio de sequenciamento de Sanger) aproximadamente 400 amostras, sendo que 190 serão de parentes ou pacientes com Distrofia Muscular de Duchenne (DMD) e 190 de parentes ou pacientes com Fissura Labiopalatina Não Sindrômica (FLP NS). A análise dos resultados será feita com o uso de dois programas, o Sequencher 5.1 e o Mixed Sequence Reader. Com a caracterização dos diferentes padrões de motivos de repetição, teremos também subsídios para testarmos a relação entre diferentes motivos e controle de expressão gênica de EIF4A3.

Publicações científicas
(Referências obtidas automaticamente do Web of Science e do SciELO, por meio da informação sobre o financiamento pela FAPESP e o número do processo correspondente, incluída na publicação pelos autores)
HSIA, GABRIELLA S. P.; MUSSO, CAMILA M.; ALVIZI, LUCAS; BRITO, LUCIANO A.; KOBAYASHI, GERSON S.; PAVANELLO, RITA C. M.; ZATZ, MAYANA; GARDHAM, ALICE; WAKELING, EMMA; ZECHI-CEIDE, ROSELI M.; BERTOLA, DEBORA; PASSOS-BUENO, MARIA RITA. Complexity of the 5 ` Untranslated Region of EIF4A3, a Critical Factor for Craniofacial and Neural Development. FRONTIERS IN GENETICS, v. 9, APR 25 2018. Citações Web of Science: 0.

Por favor, reporte erros na lista de publicações científicas escrevendo para: cdi@fapesp.br.