Busca avançada
Ano de início
Entree


Produção de leptina recombinante bovina em leveduras Pichia pastoris e avaliação da atividade biológica

Texto completo
Autor(es):
Marina Vieira de Carvalho
Número total de Autores: 1
Tipo de documento: Tese de Doutorado
Imprenta: Pirassununga.
Instituição: Universidade de São Paulo (USP). Faculdade de Medicina Veterinária e Zootecnia
Data de defesa:
Membros da banca:
Luis Felipe Prada e Silva; Flavio Vieira Meirelles; Guilherme de Paula Nogueira; Felipe Perecin; Angélica Simone Cravo Pereira
Orientador: Luis Felipe Prada e Silva
Resumo

No experimento 1, avaliou-se os efeitos da leptina exógena na concentração sérica de leptina e na expressão do gene LEP no tecido adiposo de novilhas zebuínas pré-púberes. Amostras de tecido adiposo (mesentérico, perirenal e subcutâneo) e de sangue foram obtidas de 36 novilhas, distribuídas nos tratamentos: A) dieta de alta energia; B) dieta de baixa energia; BL) dieta de baixa energia + 4,8 g/kg PV de oLeptin subcutânea, duas vezes ao dia, por 56 dias. A concentração de leptina foi determinada com kit comercial ELISA (Cusabio) específico. Amostras de sangue de quatro novilhas por grupo foram coletadas em seis pontos no tempo, sendo um antes e um após o tratamento hormonal. Dois dias após a obtenção da puberdade, oito novilhas por grupo foram abatidas para coleta de tecido. A expressão gênica foi quantificada nos depósitos de gordura por PCR em tempo real. A oLeptina aumentou transitoriamente a concentração de leptina do grupo BL, com pico (11,1 ± 1,4 ng/mL) após 7 dias do início do tratamento. A leptina sérica do grupo A aumentou linearmente no tempo, enquanto no grupo B, manteve-se constante (4,0 ± 2,0 ng/mL). A dieta A aumentou a expressão de leptina no tecido adiposo em 2,4 vezes; e a administração de oLeptina diminuiu a expressão do gene LEP em cerca de 2,5 vezes, comparando com o grupo controle. A redução na expressão do gene LEP explica a redução na leptina sérica do grupo BL após 30 dias de tratamento hormonal. O objetivo do experimento 2 foi clonar a região codificadora da leptina bovina, transformar leveduras Pichia pastoris KM71H e expressar a proteína no meio de cultura. O gene da leptina foi amplificado em reação de PCR, a partir de amostra de tecido adiposo subcutâneo de novilha do grupo A. Os primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (senso) e 5\' - ATTGTCGACGCACCCGGGACTGAGGT - 3\' (antisenso), contendo sítios EcoRI e SalI, foram desenhados com base na sequência do mRNA da leptina bovina (NM 173928.2), substituindo a sequência sinal de secreção nativa pela sequência do Fator do Saccharomyces cereviasiae. O inserto foi clonado nos vetores de expressão pPICZαA e pGAPZαA (Invitrogen), sendo as leveduras transformadas por eletroporação. Clones com múltiplas cópias do gene foram selecionados em meio YPD + 500 μg/mL de zeocina, e 22 colônias recombinantes foram selecionadas para análise de expressão em pequena escala. Colônias pPICbLep foram inicialmente cultivadas em meio de crescimento (BMGY), sendo transferidas para meio de indução (BMMY), contendo metanol. A indução durou 144 horas. Alíquotas de 200 μl de sobrenadante foram coletadas diariamente, para análise da presença da bLeptina por SDS-PAGE. As colônias pGAPbLep foram cultivadas em meio YPD por 96 h, com coleta de sobrenadante a cada 24 h. As leveduras foram transformadas com sucesso, com os plasmídeos pPICbLep e pGAPbLep, entretanto, apenas as colônias pGAPbLep expressaram uma proteína de 35 kDa, o dobro do tamanho esperado para a bLeptina (17 kDa), provavelmente por ocorrência de dimerização. Mais estudos são necessários sobre os processos de produção de leptina recombinante bovina em Pichia pastoris. (AU)

Processo FAPESP: 11/02206-0 - Produção de leptina recombinante bovina em levedura Pichia pastoris e avaliação da atividade biológica.
Beneficiário:Marina Vieira de Carvalho
Linha de fomento: Bolsas no Brasil - Doutorado