| Full text | |
| Author(s): |
Francisca Elda Ferreira Dias
[1]
;
Cáris Marone Nunes
[2]
;
Tânia Vasconcelos Cavalcante
[3]
;
Andréa Azevedo Pires de Castro
[4]
;
Jorge Luis Ferreira
[5]
;
José Fernando Garcia
[6]
Total Authors: 6
|
| Affiliation: | [1] Universidade Federal do Tocantins - Brasil
[2] Universidade Estadual Paulista - Brasil
[3] Universidade Federal do Tocantins - Brasil
[4] Universidade Federal do Tocantins - Brasil
[5] Universidade Federal do Tocantins - Brasil
[6] Universidade Estadual Paulista - Brasil
Total Affiliations: 6
|
| Document type: | Journal article |
| Source: | Ciênc. anim. bras.; v. 14, n. 3, p. 366-372, 2013-09-00. |
| Abstract | |
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers. (AU) | |